TRS-2 PPMO
A peptide-conjugated morpholino oligomer.
General information
TRS-2 PPMO is a morpholino (single-stranded nucleic acid analogue) oligomer, designed to base-pair with the leader transcription regulatory sequence region (bases 59-82) of SARS-CoV-2 genome, covalently bound to a cell-penetrating peptide (Rosenke et al., 2020).
TTTTAAAGTTCGTTTAGAGAACAG (morpholino part)
Supporting references
| Link | Tested on | Impact factor | Notes | Publication date |
|---|---|---|---|---|
|
Inhibition of SARS-CoV-2 in Vero cell cultures by peptide-conjugated morpholino oligomers
RNA Protein factor In vitro Mixed substance |
Vero E6 cells | 5.44 | Effectively inhibits replication of SARS-CoV-2 in cell culture in a dose-responsive manner at non-toxic concentrations. |
Nov/09/2020 |