rlcv-miR-rL1-28-3p
A plant derived miRNA.
General information
rlcv-miR-rL1-28-3p is a ginger derived miRNA. It can be transported via exosome-like nanoparticles. The miRNA reduced SARS-CoV-2-induced cytopathic effect in vitro. It inhibits the expression of the Spike gene (Teng et al., 2021).
rlcv-miR-rL1-28-3p on miRBase
3'–GAGGAAAGUAUCGCCUUCUAG–5'
Supporting references
| Link | Tested on | Impact factor | Notes | Publication date |
|---|---|---|---|---|
|
Plant-derived exosomal microRNAs inhibit lung inflammation induced by exosomes SARS-CoV-2 Nsp12
Spike protein RNA nsp13 nsp12 Cell-based therapy Animal model In vitro Mechanism Mixed substance Extracellular vesicles |
Vero E6 cells; C57BL/6 mice; SARS-CoV-2 strain USA-WA1/2020 | 11.45 | Ginger-derived exosome-like nanoparticles carrying the miRNA reduced SARS-CoV-2-induced cytopathic effect in vitro. It inhibits the expression of the Spike gene. |
May/10/2021 |