mmu-miR-200c

A murine micro RNA.

Phase of research

Potential treatment - theoretical effect

How it helps

Other treatment

Drug status

Natural product

1
Supporting references
0
Contradictory references
0
AI-suggested references
0
Clinical trials

General information

mmu-miR-200c is a micro RNA partially complementary to the ACE2 3'UTR. It was shown to downregulate ACE2 expression in cardiomyocytes in vitro (Murohashi et al., 2020).

mmu-miR-200c on miRBase

 

5 -  cgucuuacccagcaguguuugg  - 26


Supporting references

Link Tested on Impact factor Notes Publication date
MicroRNAs targeting the SARS-CoV-2 entry receptor ACE2 in cardiomyocytes
RNA In vitro In silico
in silico; neonatal rat cardiomyocytes; cord blood derived human induced pluripotent stem cells; HEK 293 T cells 4.13

mmu-miR-200c was shown to downregulate ACE2 expression in cardiomyocytes in vitro and thus was suggested for inhibition of SARS-CoV-2 cell infection mediated by ACE2.

Sep/03/2020