hsa-miR-1307-3p

A human miRNA.

Phase of research

Potential treatment - theoretical effect

How it helps

Antiviral

Drug status

Natural product

1
Supporting references
0
Contradictory references
0
AI-suggested references
0
Clinical trials

General information

hsa-miR-1307-3p on miRBase

 

80 -  acucggcguggcgucggucgug  - 101


Supporting references

Link Tested on Impact factor Notes Publication date
Predicted therapeutic targets for COVID-19 disease by inhibiting SARS-CoV-2 and its related receptors
ACE2 RNA TMPRSS2 Small molecule In silico
in silico 2.11

Predicted to bind the SARS-CoV-2 3′UTR.

Aug/07/2020