hsa-miR-1307-3p
A human miRNA.
General information
hsa-miR-1307-3p on miRBase
80 - acucggcguggcgucggucgug - 101
Supporting references
| Link | Tested on | Impact factor | Notes | Publication date |
|---|---|---|---|---|
|
Predicted therapeutic targets for COVID-19 disease by inhibiting SARS-CoV-2 and its related receptors
ACE2 RNA TMPRSS2 Small molecule In silico |
in silico | 2.11 | Predicted to bind the SARS-CoV-2 3′UTR. |
Aug/07/2020 |